csgB

Information for csgB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1101769-1102419 - CDS csgD EG13410 putative 2-component transcriptional regulator for 2nd curli operon 1103174-1103629 + CDS csgB EG12621 minor curlin subunit precursor; similar ro CsgA 1103670-1104125 + CDS csgA EG11489 curlin major subunit; coiled surface structures; cryptic

Reported regulatory sites for csgB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.945 1103080-1103098 ttcca TCGTAACGCAGCGTTAACA aaata - 0 - 3.671 1102704-1102725 ttatt GCACAATTTTAAAAAATCATAC aaatg - 0 - 3.671 1103041-1103062 gcgcg GGTGAGTTATTAAAAATATTTC cgcag - 0 - 2.637 1103005-1103028 aatac TTTGGTATGAACTAAAAAAGAAAA ataca - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back