csgC

Information for csgC, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1103670-1104125 + CDS csgA EG11489 curlin major subunit; coiled surface structures; cryptic 1104184-1104516 + CDS csgC EG13414 putative curli production protein 1104637-1104948 + CDS b1044 EG13873 orf; hypothetical protein

Reported regulatory sites for csgC: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 11.048 1104145-1104166 tacag AAACAGGGCGCAAGCCCTGTTT ttttt - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.011 1104165-1104181 cctgt TTTTTTTCGGGAGAAGA atatg - 0 - 3.668 1104123-1104141 agtac TAATACATCATTTGTATTA cagaa - 0 - -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back