cspB

Information for cspB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1638394-1638684 - CDS b1556 EG13831 orf; hypothetical protein 1639363-1639578 - CDS cspB EG12203 cold shock protein; may affect transcription 1639879-1640091 + CDS cspF EG12205 cold shock protein

Reported regulatory sites for cspB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.529 1639722-1639738 R ttgcg TCGGTTTGAAGAACAGA cgata - 0 - 0.489 1639754-1639775 R taaac ATTGCTTCATATGTTCAACTAT gcgtt - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back