cspE

Information for cspE, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 655780-656340 + CDS crcA EG12180 orf; hypothetical protein 656515-656724 + CDS cspE EG12179 cold shock protein 656778-657161 - CDS crcB EG12209 orf; hypothetical protein

Reported regulatory sites for cspE: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.586 656473-656489 taacc GACACAGCATTTGTGTC tattt - 0 - 3.778 656402-656421 aaaat AACGCGACTTTTATCACTTT ttagt - 0 - 2.274 656454-656471 accac AATTGGTGTACTGGTAAC cgaca - 0 - 2.274 656493-656510 tctat TTTTCATGTAAAGGTAAT tttga - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back