cspF

Information for cspF, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1639363-1639578 - CDS cspB EG12203 cold shock protein; may affect transcription 1639879-1640091 + CDS cspF EG12205 cold shock protein 1640513-1641295 - CDS b1559 EG13832 orf; hypothetical protein

Reported regulatory sites for cspF: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.475 1639764-1639783 tgaac ATATGAAGCAATGTTTATTT tagac - 0 - 0.584 1639843-1639861 gtgtg TATAGTGCGCCAAGTTATC agtat - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back