cspG

Information for cspG, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1050186-1050398 - CDS cspH EG14281 cold shock-like protein 1050684-1050896 + CDS cspG EG14243 homolog of Salmonella cold shock protein 1051070-1051300 + CDS sfa EG13232 suppresses fabA and ts growth mutation

Reported regulatory sites for cspG: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.469 1050444-1050467 gttaa TAAAATAAAGCCAGCGATATTTAA gaccg - 0 - 0.724 1050399-1050421 gacaa ACAAATTCCTTACTGAAAATACT gcgct - 0 - 0.724 1050488-1050510 aaaat AAAATTTGCTTAATCTCAATTAT catgc - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back