cspH

Information for cspH, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1049250-1049753 + CDS insB_4 - IS1 protein InsB 1050186-1050398 - CDS cspH EG14281 cold shock-like protein 1050684-1050896 + CDS cspG EG14243 homolog of Salmonella cold shock protein

Reported regulatory sites for cspH: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 7.085 1050446-1050465 R gtctt AAATATCGCTGGCTTTATTT tatta - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 0.922 1050466-1050483 R tattt TAGCCGTCCGGCGGTCTT aaata - 0 - 0.255 1050488-1050510 R gcatg ATAATTGAGATTAAGCAAATTTT atttt - 0 - 0.255 1050399-1050421 R agcgc AGTATTTTCAGTAAGGAATTTGT ttgtc - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back