cspI

Information for cspI, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1635978-1636169 - CDS b1551 EG14388 orf; hypothetical protein 1636479-1636691 - CDS cspI EG13877 cold shock-like protein 1637054-1637551 - CDS b1553 EG13828 orf; hypothetical protein

Reported regulatory sites for cspI: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.887 1636797-1636819 R aaatt TATCTGAAGCAGTCATTGTTATA atttt - 0 - 2.595 1636711-1636730 R ggacc ATTCTGCCCAAGGGCTAATT tcttc - 0 - 2.048 1636863-1636884 R tcttt ACAAAAGTAATCCTTGCTATGG gtggt - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back