cstA

Information for cstA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 628523-628936 + CDS ybdB EG11105 orf; hypothetical protein 629117-631222 + CDS cstA EG10167 carbon starvation protein 631612-632700 - CDS ybdH EG12692 putative oxidoreductase

Reported regulatory sites for cstA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.464 628998-629020 aacat TGTTAAGTTAAATATTGGTTTCA actcc - 0 - 3.464 629064-629086 aaaga TGTTATAGAAACAAAATGTAACA tctct - 0 - 2.256 629028-629051 tccga TTTACATGGTTGCTGTGTTGTTAA attgt - 0 - 1.896 628954-628971 tagat GAGATTGCAGGAAAACTC ggtta - 0 - 1.896 628980-628997 taacg GAGTGATCGAGTTAACAT tgtta - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back