cstC

Information for cstC, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1827755-1828789 - CDS b1747 EG13998 orf; hypothetical protein 1828786-1830006 - CDS cstC EG13999 acetylornithine delta-aminotransferase 1830452-1831258 + CDS xthA EG11073 exonuclease III

Reported regulatory sites for cstC: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.051 1830274-1830292 R gcgca GTAATTTCCAGTAAATTTC gtcaa - 0 - 4.931 1830163-1830184 R gtatt CACTTTATATGCACTTTAAATG catat - 0 - 3.643 1830245-1830266 R caatg ATCACAATTCCAGAATTATATT ttact - 0 - 3.643 1830021-1830042 R attaa CATATAAATAACGAATTATTTA ctgta - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back