cutA

Information for cutA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4360923-4362620 - CDS dsbD EG12178 thiol:disulfide interchange protein; copper tolerance 4362596-4362934 - CDS cutA EG12177 divalent cation tolerance protein; cytochrome c biogenesis 4363050-4364351 - CDS dcuA EG11225 anaerobic dicarboxylate transport

Reported regulatory sites for cutA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.321 4363021-4363039 R aatcg CGGGGCGTTCACGCCCCGC tttct - 0 - 2.202 4362973-4362989 R ccccc GTCCGTTGTATAGTGAC ctctc - 0 - 1.981 4362962-4362981 R cgttg TATAGTGACCTCTCTCTTGC ggttc - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back