cutC

Information for cutC, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1955056-1956156 - CDS yecK EG13277 putative cytochrome C-type protein 1956544-1956984 - CDS cutC EG12956 copper homeostasis protein 1957304-1957876 - CDS yecM EG13405 orf; hypothetical protein

Reported regulatory sites for cutC: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.132 1957173-1957196 R cccaa AAGAGGGGGGCTTAACGCCGTCGT tgggt - 0 - 3.208 1957255-1957274 R ggaaa TTTGCTGTTACAGCATGGAA tgtgc - 0 - 3.208 1957081-1957100 R tggtg ATTTTTGCTACAGCGACGGT gagtt - 0 - 2.853 1957223-1957245 R cacta ACGGCGCAGCAAAACGGCGCAGA cagag - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back