cvpA

Information for cvpA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2426741-2428258 - CDS purF EG10794 amidophosphoribosyltransferase = PRPP amidotransferase 2428295-2428783 - CDS cvpA EG10169 membrane protein required for colicin V production 2429042-2429677 - CDS dedD EG10218 putative lipoprotein

Reported regulatory sites for cvpA: Genome coordinates Source Transcription factor Transcription factor annotation 2428835-2428860 DPInteract purR transcriptional repressor for pur regulon glyA glnB prsA speA

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 8.856 2428840-2428855 R tccct ACGCAAACGTTTTCTT tttct purR 16 - 3.476 2428817-2428838 R tcttt TTCTGTTAGAATGCGCCCCGAA cagga purR 4 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.497 2428889-2428908 R gatgg CGTTGAATATTTTTTCAGCG ccatt - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back