cyaA

Information for cyaA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3987438-3988400 - CDS hemC EG10429 porphobilinogen deaminase = hydroxymethylbilane synthase 3988766-3991312 + CDS cyaA EG10170 adenylate cyclase 3991352-3991672 - CDS cyaY EG11653 orf; hypothetical protein

Reported regulatory sites for cyaA: Genome coordinates Source Transcription factor Transcription factor annotation 3988594-3988615 DPInteract crp cyclic AMP receptor protein

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.431 3988593-3988616 tcagc AAGGTGTTAAATTGATCACGTTTT agacc crp 22 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.743 3988624-3988647 accat TTTTTCGTCGTGAAACTAAAAAAA ccagg - 0 - 1.509 3988549-3988570 aacgg TGCTACACTTGTATGTAGCGCA tcttt - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back