cybB

Information for cybB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1487985-1488389 - CDS gapC_1 EG12103 glyceraldehyde 3-phosphate dehydrogenase C; interrupted 1488890-1489456 + CDS cybB EG10172 cytochrome b(561) 1489701-1489874 + CDS ydcA EG11219 orf; hypothetical protein

Reported regulatory sites for cybB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.435 1488858-1488875 tgaac AATATTTAATGAAATTTT gagaa - 0 - 0.063 1488702-1488725 cgacc GATACGACCAAAACCGTTAATACC aactt - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back