cybC

Information for cybC, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4455533-4456885 + CDS pmbA EG10741 maturation of antibiotic MccB17; see tld genes 4457127-4457429 + CDS cybC EG50008 cytochrome b(562) 4457474-4457938 - CDS nrdG EG12523 anaerobic ribonucleotide reductase activating protein

Reported regulatory sites for cybC: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.812 4457092-4457115 attca GTTCGGCGTCATTTGCTGCTGATC tcgaa - 0 - 0.632 4457068-4457087 tattc TTGCAGTCTCCTCGTTGGTA ttcag - 0 - 0.626 4456910-4456933 cgcgc TATAAACTAAAAAATTACACAAAA tcatt - 0 IRU18 (4)

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back