cydA

Information for cydA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 767201-769834 + CDS ybgG EG13236 putative sugar hydrolase 770678-772249 + CDS cydA EG10173 cytochrome d terminal oxidase; polypeptide subunit I 772265-773404 + CDS cydB EG10174 cytochrome d terminal oxidase polypeptide subunit II

Reported regulatory sites for cydA: Genome coordinates Source Transcription factor Transcription factor annotation 770304-770318 DPInteract arcA negative response regulator of genes in aerobic pathways (sensors ArcB and CpxA) 770519-770533 DPInteract arcA negative response regulator of genes in aerobic pathways (sensors ArcB and CpxA) 770071-770085 DPInteract arcA negative response regulator of genes in aerobic pathways (sensors ArcB and CpxA) 770093-770107 DPInteract arcA negative response regulator of genes in aerobic pathways (sensors ArcB and CpxA) 770381-770402 DPInteract fnr transcriptional regulation of aerobic anaerobic respiration osmotic balance 770426-770447 DPInteract fnr transcriptional regulation of aerobic anaerobic respiration osmotic balance

Species with an ortholog: HI SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.942 770330-770349 tgtag GAATTGATATTTATCAATGT ataag - 0 - 3.942 770382-770401 gagat AAATTGTTCTCGATCAAATT ggctg fnr 20 - 3.381 770446-770461 cgaaa AATGCAAATTTGCTTC aacaa fnr 2 - 3.381 770595-770610 gtgtt CAAACAAATTTCTATT ggggc - 0 - 3.337 770467-770489 aacaa AAACCTGTTTATTGTAAGGATTT tgcgg - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back