cydD

Information for cydD, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 926697-928418 - CDS cydC EG10012 ATP-binding component of cytochrome-related transport 928419-930185 - CDS cydD EG11405 ATP-binding component of cytochrome-related transport; Zn sensitive 930308-931273 - CDS trxB EG11032 thioredoxin reductase

Reported regulatory sites for cydD: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.859 930288-930309 R aaaat AATTTTACAAATCAGTAACAAA agtaa - 0 - 3.859 930227-930248 R ccttt ATTTTTTCCCCGTTGTAACATT gctct - 0 - 2.239 930186-930202 R taact CACCTGCTAAGCGTGCA atgaa - 0 - 2.193 930251-930269 R acacc ATGCGACTATGGGTCGCCT ttatt - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back