cynR

Information for cynR, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 355395-356678 + CDS codA EG11326 cytosine deaminase 357015-357914 - CDS cynR EG11421 cyn operon positive regulator 358023-358682 + CDS cynT EG10176 carbonic anhydrase

Reported regulatory sites for cynR: Genome coordinates Source Transcription factor Transcription factor annotation 357953-357973 DPInteract cynR cyn operon positive regulator 357921-357941 DPInteract cynR cyn operon positive regulator

Species with an ortholog: PA ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.016 357989-358008 R ctgtc TGTCTCTGGAATGAGAGGCA gacta - 0 - 0.717 357946-357967 R tcata AGGTAAAAGTCTCATTTATGAT gagtt cynR 15 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back