cynT

Information for cynT, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 357015-357914 - CDS cynR EG11421 cyn operon positive regulator 358023-358682 + CDS cynT EG10176 carbonic anhydrase 358713-359183 + CDS cynS EG10175 cyanate aminohydrolase; cyanase

Reported regulatory sites for cynT: Genome coordinates Source Transcription factor Transcription factor annotation 357953-357973 DPInteract cynR cyn operon positive regulator 357921-357941 DPInteract cynR cyn operon positive regulator

Species with an ortholog: PA EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 0.381 357987-358010 agtag TCTGCCTCTCATTCCAGAGACAGA cagag - 0 - -

Critical MAP values: p=0.01 3.34 p=0.05 2.41 p=0.1 2.01 p=0.2 1.55

Click here to go back