cyoA

Information for cyoA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 447874-449865 - CDS cyoB EG10179 cytochrome o ubiquinol oxidase subunit I 449887-450834 - CDS cyoA EG10178 cytochrome o ubiquinol oxidase subunit II 451294-452769 - CDS ampG EG12183 regulates beta-lactamase synthesis

Reported regulatory sites for cyoA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 7.366 450894-450915 R taatc ATGTTTACAGTAATGTAACCTT cccgt - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.100 450869-450890 R ttccc GTAAAATGCCCACACACTTTAA acgcc - 0 - 4.168 451046-451062 R tttca CATTGGTTATACCAATT gcccg - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back