cysK

Information for cysK, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2529483-2530244 + CDS cysZ EG10003 required for sulfate transport 2530429-2531400 + CDS cysK EG10192 cysteine synthase A; O-acetylserine sulfhydrolase A 2531784-2532041 + CDS ptsH EG10788 PTS system protein HPr

Reported regulatory sites for cysK: Genome coordinates Source Transcription factor Transcription factor annotation 2530280-2530319 DPInteract cysB positive transcriptional regulator for cysteine regulon 2530324-2530363 DPInteract cysB positive transcriptional regulator for cysteine regulon

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.106 2530330-2530349 tattt CCCTTCTGTATATAGATATG ctaaa cysB 20 - 3.106 2530401-2530420 tgtat CCCAATTTCATACAGTTAAG gacag - 0 - 1.420 2530350-2530365 atatg CTAAATCCTTACTTCC gcata cysB 14 - 1.123 2530367-2530387 ttccg CATATTCTCTGAGCGGGTATG ctacc - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back