dbpA

Information for dbpA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1406074-1407057 + CDS b1342 EG13356 orf; hypothetical protein 1407535-1408908 + CDS dbpA EG10210 ATP-dependent RNA helicase 1409037-1409972 - CDS ydaO EG13357 orf; hypothetical protein

Reported regulatory sites for dbpA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.167 1407227-1407243 gcata GCACAATTGATTCGTAC gacgc - 0 - 1.932 1407126-1407142 actct CTACCCATTCAGGGCAA tatct - 0 - 1.932 1407294-1407310 agcgt CTACCCTTTAAGAGTCC accca - 0 - 1.675 1407447-1407469 cgatg AAGAACCGATTAAATTGTCGCAT cgtga - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back