dcuA

Information for dcuA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4362596-4362934 - CDS cutA EG12177 divalent cation tolerance protein; cytochrome c biogenesis 4363050-4364351 - CDS dcuA EG11225 anaerobic dicarboxylate transport 4364469-4365950 - CDS aspA EG10095 aspartate ammonia-lyase (aspartase)

Reported regulatory sites for dcuA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.485 4364366-4364388 R aacaa TCTAATATCAACTTGTTAAAAAA caagg - 0 - 2.794 4364448-4364471 R aacag TAATCGTACAGGGTAGTACAAATA aaaaa - 0 - 1.466 4364422-4364444 R taaaa AAGGCACGTCAGATGACGTGCCT ttttt - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back