ddlA

Information for ddlA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 398685-399029 + CDS b0380 EG14280 orf; hypothetical protein 399053-400147 - CDS ddlA EG10213 D-alanine-D-alanine ligase A 400610-400870 + CDS yaiB EG11256 orf; hypothetical protein

Reported regulatory sites for ddlA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.328 400191-400212 R gaagg CCGCGAATCCCCCGTTTTGTCG tggta - 0 - 1.754 400510-400527 R ttatg ACAAAGGAAATACTTTGC gcaaa - 0 - 1.754 400171-400188 R tcgtg GTAATGTATGCACTTTGT gttag - 0 - 1.393 400221-400237 R agcag AAGATTGCAACAATCTT tcaga - 0 - -

Critical MAP values: p=0.01 6.09 p=0.05 4.94 p=0.1 4.37 p=0.2 3.74

Click here to go back