def

Information for def, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3430436-3431197 - CDS smf_1 EG11604 orf; fragment 1 3431327-3431836 + CDS def EG11440 peptide deformylase 3431851-3432798 + CDS fmt EG11268 10-formyltetrahydrofolate:L-methionyl-tRNA(fMet) N-formyltransferase

Reported regulatory sites for def: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.711 3431270-3431288 gggga TTTGTCTAGAATAGAAGAA ataat - 0 - 2.373 3431253-3431276 gatgc TGTCAATCAGAGGGGGATTTGTCT agaat - 0 - 1.906 3431239-3431261 tgcga TTGGTCAGTGATGCTGTCAATCA gaggg - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back