degS

Information for degS, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3378378-3379745 + CDS degQ EG12612 serine endoprotease 3379835-3380902 + CDS degS EG11652 protease 3380965-3381903 - CDS mdh EG10576 malate dehydrogenase

Reported regulatory sites for degS: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.726 3379780-3379803 tgatg TCCGGTTAACTCGTGGTATGCTGC tgccg - 0 - 2.115 3379754-3379775 cgtaa ACCGGGCATCAGGCTTACGTGT gatgt - 0 - 1.248 3379809-3379829 tgccg TTCCCTTTTTTAATGACGCCT ccatc - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back