deoD

Information for deoD, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4617172-4618395 + CDS deoB EG10220 phosphopentomutase 4618452-4619171 + CDS deoD EG10222 purine-nucleoside phosphorylase 4619338-4620669 + CDS yjjJ EG12342 orf; hypothetical protein

Reported regulatory sites for deoD: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 0.671 4618427-4618448 ccttt GTTATGTCACAAAAAGGATAAA acaat - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back