dinG

Information for dinG, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 831691-832173 - CDS ybiA EG11579 orf; hypothetical protein 832293-834443 + CDS dinG EG11357 probably ATP-dependent helicase 834471-835433 + CDS ybiB EG11580 putative enzyme

Reported regulatory sites for dinG: Genome coordinates Source Transcription factor Transcription factor annotation 832259-832278 DPInteract lexA regulator for SOS(lexA) regulon

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.643 832257-832280 gccac AATATTGGCTGTTTATACAGTATT tcagg lexA 20 - 1.615 832209-832225 gccgc TTTCCAGAAACAGAAAA accat - 0 - 0.873 832275-832291 tatac AGTATTTCAGGTTTTCT catgg lexA 4 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back