dinI

Information for dinI, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1119924-1120178 - CDS yceP EG14335 orf; hypothetical protein 1120465-1120710 - CDS dinI EG12670 damage-inducible protein I 1120784-1121830 - CDS pyrC EG10806 dihydro-orotase

Reported regulatory sites for dinI: Genome coordinates Source Transcription factor Transcription factor annotation 1120730-1120749 DPInteract lexA regulator for SOS(lexA) regulon

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 6.664 1120731-1120748 R tttta CCTGTATAAATAACCAGT atatt lexA 18 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.007 1120712-1120730 R ccagt ATATTCAACAGGGGGCTAT tatgc lexA 1 - 0.445 1120764-1120785 R acaat AAAAATCGTAGCTTCCTGTTGT catta - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back