dnaK

Information for dnaK, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 11382-11786 - CDS yaaI EG11513 orf; hypothetical protein 12163-14079 + CDS dnaK EG10241 chaperone Hsp70; DNA biosynthesis; autoregulated heat shock proteins 14168-15298 + CDS dnaJ EG10240 chaperone with DnaK; heat shock protein

Reported regulatory sites for dnaK: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.760 11877-11898 ttctt TTTATTACAATTTTTTGATGAA tgcct - 0 - 2.760 11987-12008 gcaaa AGCACAAAAAATTTTTGCATCT ccccc - 0 - 1.943 11914-11932 gcgat TCATTCTTTATATGAATAA aattg - 0 - 1.943 12060-12078 gtgag TGAGTCTGCAAAAAAATGA aattg - 0 - 1.940 12015-12037 cccct TGATGACGTGGTTTACGACCCCA tttag - 0 - 1.940 12090-12112 gcagt TGAAACCAGACGTTTCGCCCCTA ttaca - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back