dnaX

Information for dnaX, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 490636-491187 + CDS apt EG10051 adenine phosphoribosyltransferase 491316-493247 + CDS dnaX EG10245 DNA polymerase III; tau and gamma subunits; DNA elongation factor III 493300-493629 + CDS ybaB EG11100 orf; hypothetical protein

Reported regulatory sites for dnaX: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.676 491241-491264 attca GCCTCGCCGTTCTGACGGGGCTGT gttag - 0 - 1.676 491290-491313 aatcc ACCTTCCAGCGTTTCAGAGCCTGC caatg - 0 - 0.708 491268-491289 gtgtt AGCATTACCCCTTCGTGAATCC acctt - 0 - 0.615 491189-491207 ttaat TATCGCCAGTCTTGTGCTG cccac - 0 - 0.615 491221-491239 acgga CAGCACAAGATGTGCATTC agcct - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back