dps

Information for dps, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 846481-847227 - CDS glnH EG10386 periplasmic glutamine-binding protein; permease 847631-848134 - CDS dps EG11415 global regulator; starvation conditions 848433-849320 - CDS ybiF EG12134 putative transmembrane subunit

Reported regulatory sites for dps: Genome coordinates Source Transcription factor Transcription factor annotation 848247-848294 DPInteract ihf integration host factor (IHF) 848209-848247 DPInteract oxyR activator hydrogen peroxide-inducible genes

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.367 848394-848415 R gcatg GTTATGCATAACCATGCAGAAT ttctc - 0 - 3.177 848166-848184 R tgcta TACTTAATCTCGTTAATTA ctggg - 0 - 2.942 848220-848236 R ttacc ACTATTAGTGTGATAGG aacag oxyR 17 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back