ebgR

Information for ebgR, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3218556-3218888 - CDS ygjH EG12719 putative tRNA synthetase 3219107-3220090 + CDS ebgR EG10254 regulator of ebg operon 3220238-3223366 + CDS ebgA EG10252 evolved beta-D-galactosidase; alpha subunit; cryptic gene

Reported regulatory sites for ebgR: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.095 3218900-3218920 ctccc TTAGGGTAAAATTTTACTAAA ctata - 0 - 3.095 3218922-3218942 taaac TATAGCAAAAGTTTTTCTCAA tcctg - 0 - 1.092 3219014-3219033 gcgtc AAAGAAACGCGCTTTATTTA ctgaa - 0 -

Critical MAP values: p=0.01 4.78 p=0.05 3.24 p=0.1 2.72 p=0.2 2.16

Click here to go back