ecpD

Information for ecpD, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 152829-155426 - CDS htrE EG11972 probable outer membrane porin protein involved in fimbrial assembly 155461-156201 - CDS ecpD EG11973 probable pilin chaperone similar to PapD 156299-156883 - CDS yadN EG12328 putative fimbrial-like protein

Reported regulatory sites for ecpD: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.219 156235-156257 R ggaat AATAATTTCTATTTTATATTATT ccctg - 0 - 3.171 156273-156289 R tcacc AGTTAAATTGATTGAAT gaata - 0 - 2.025 156258-156279 R aattg ATTGAATGAATATACAGGGAAT aataa - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back