edd

Information for edd, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1930139-1930780 - CDS eda EG10256 2-keto-3-deoxygluconate 6-phosphate aldolase and 2-keto-4-hydroxyglutarate aldolase 1930817-1932628 - CDS edd EG10257 6-phosphogluconate dehydratase 1932863-1934338 - CDS zwf EG11221 glucose-6-phosphate dehydrogenase

Reported regulatory sites for edd: Genome coordinates Source Transcription factor Transcription factor annotation 1932726-1932741 DPInteract fruR transcriptional repressor of fru operon and others

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.018 1932789-1932810 R cgcag ATTGTAGAACAATTTTTACACT ttcag - 0 - 1.837 1932821-1932840 R tatgg TTATTTTACCGGTAACATGA tcttg - 0 - 1.645 1932759-1932782 R tcagg CCTCGTGCGGATTCACCCACGAGG ctttt - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back