elaD

Information for elaD, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2379610-2380545 + CDS elaC EG14260 orf; hypothetical protein 2380733-2381944 + CDS elaD EG14261 putative sulfatase / phosphatase 2382015-2383742 - CDS yfbK EG14095 orf; hypothetical protein

Reported regulatory sites for elaD: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 0.854 2380547-2380566 ttaac TCTGCTTATTATTAAAAACA gggcg - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back