emrK

Information for emrK, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2478658-2480196 - CDS emrY EG13283 multidrug resistance protein Y 2480196-2481359 - CDS emrK EG13282 multidrug resistance protein K 2481775-2482389 + CDS evgA EG11609 putative positive transcription regulator (sensor EvgS)

Reported regulatory sites for emrK: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 0.976 2481680-2481699 R tttct CAATAAAAATAAGAAAATCT gagct - 0 - 0.976 2481605-2481624 R aaatg AAATGTCAACAATAAAATCA gggat - 0 - 0.885 2481471-2481486 R ttgca CCTCATTTAAATTAGG cctcc - 0 - - 0.192 2481427-2481450 R ggata ATGTGCAACACATGCACTGTGTTT gatat - 0 - 0.192 2481400-2481423 R ttgat ATGAAGAATGAATGCTCTTTTCAT tcaat - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back