endA

Information for endA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3087774-3088271 + CDS sprT EG12122 orf; hypothetical protein 3088366-3089073 + CDS endA EG11336 DNA-specific endonuclease I 3089126-3089884 + CDS yggJ EG12366 orf; hypothetical protein

Reported regulatory sites for endA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.763 3088284-3088299 aacta TCAGGAACTTTCCTGA tctgg - 0 - 3.763 3088327-3088342 cagct TTCGCTACGTTGCTGG ctcgt - 0 - 0.962 3088304-3088325 atctg GCTGATTGCATACCAAAACAGC tttcg - 0 - 0.736 3088343-3088359 gctgg CTCGTTTTAACACGGAG taagt - 0 -

Critical MAP values: p=0.01 5.40 p=0.05 4.29 p=0.1 3.77 p=0.2 3.19

Click here to go back