eno

Information for eno, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2903664-2904605 + CDS ygcG EG13035 orf; hypothetical protein 2904665-2905963 - CDS eno EG10258 enolase 2906051-2907688 - CDS pyrG EG10810 CTP synthetase

Reported regulatory sites for eno: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.266 2905980-2906002 R tttgt CTGGAGTTTCAGTTTAACTAGTG acttg - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.257 2906012-2906028 R gcaac GCGTACCCTGGGTACGC gttgt - 0 - 0.435 2906022-2906043 R aaaaa AGTTAGAGCGGCAACGCGTACC ctggg - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back