entC

Information for entC, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 622777-623733 - CDS fepB EG10294 ferric enterobactin (enterochelin) binding protein; periplasmic component 624108-625283 + CDS entC EG10261 isochorismate hydroxymutase 2; enterochelin biosynthesis 625293-626903 + CDS entE EG10263 2;3-dihydroxybenzoate-AMP ligase

Reported regulatory sites for entC: Genome coordinates Source Transcription factor Transcription factor annotation 623945-623962 DPInteract fur negative regulator 624060-624077 DPInteract fur negative regulator

Species with an ortholog: ST EC VC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.484 623943-623965 atcca TCAATAATGCTTCTCATTTTCAT tgtaa fur 18 - 3.484 624058-624080 cgaaa ATATAAATGATAATCATTATTAA agcct fur 18 - 1.315 624031-624054 gtgcg CGTTTGCTTTTAGGTTAGCGACCG aaaat - 0 - 0.099 624002-624025 cagat TGCGTTACCTCAAGAGTTGACATA gtgcg - 0 -

Critical MAP values: p=0.01 6.82 p=0.05 5.66 p=0.1 5.03 p=0.2 4.36

Click here to go back