entD

Information for entD, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 607288-608400 + CDS yi81_2 - IS186 hypothetical protein 608682-609311 - CDS entD EG10262 enterochelin synthetase; component D 609477-611717 - CDS fepA EG10293 outer membrane receptor for ferric enterobactin (enterochelin) and colicins B and D

Reported regulatory sites for entD: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.862 609421-609442 R cgtcg TTCATGCCGGATGCGGCGTGAA cgcct - 0 REP54b (17) - 0.833 609379-609402 R ctaca AAAATCTTGCCAATTCAATATATT gcagg - 0 - -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back