envR

Information for envR, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3410258-3410437 + CDS yhdU EG12832 orf; hypothetical protein 3410440-3411102 - CDS envR EG11741 putative transcriptional regulator 3411501-3412658 + CDS acrE EG10266 transmembrane protein affects septum formation and cell membrane permeability

Reported regulatory sites for envR: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.872 3411258-3411281 R cctcg TAAATTGAAATATATATTGATGTA gtgaa - 0 - 5.872 3411218-3411241 R ttagg TAAATAATATATATTATTTATTTA acgat - 0 - 2.139 3411468-3411489 R tcctc AAAAAACCAAAAGCGCGTTATT taccc - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back