erfK

Information for erfK, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2060282-2060357 + tRNA asnV EG30022 Asparagine tRNA 2060413-2061345 - CDS erfK EG12682 orf; hypothetical protein 2061410-2062489 - CDS cobT EG12151 nicotinate-nucleotide dimethylbenzimidazole-P phophoribosyl transferase

Reported regulatory sites for erfK: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 6.094 2061370-2061390 R ataaa AGCTATACTTAACGGATAGCT ttcgc - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back