exuR

Information for exuR, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3242744-3244162 + CDS exuT EG12738 transport of hexuronates 3244277-3245068 + CDS exuR EG12739 negative regulator of exu regulon; exuT; uxaAC; and uxuB 3245413-3246075 + CDS yqjA EG12740 orf; hypothetical protein

Reported regulatory sites for exuR: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.330 3244246-3244261 cgcaa AAGTGGTATAACAAAT atagt - 0 - 2.327 3244191-3244214 ccttc AAAGCCGCCTTCTCAGGCGGCTTT ttcat - 0 - 1.342 3244223-3244244 atcac TGCGAGTAGAGCTAAACTCGCA aaagt - 0 - -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back