fabA

Information for fabA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1014938-1015105 + CDS rmf EG50004 ribosome modulation factor 1015175-1015693 - CDS fabA EG10273 beta-hydroxydecanoyl thioester dehydrase; trans-2-decenoyl-ACP isomerase 1015762-1017522 - CDS b0955 EG13718 putative ATP-dependent protease

Reported regulatory sites for fabA: Genome coordinates Source Transcription factor Transcription factor annotation 1015751-1015767 DPInteract fadR negative regulator for fad regulon and positive activator of fabA 1015732-1015749 PMID: 11160901 fabR orf hypothetical protein

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 8.219 1015732-1015749 R tgttc AGCGTACACGTGTTAGCT atcct fabR 18 - 4.190 1015703-1015725 R tcctg CGTGCTTCAATAAAATAAGGCTT acaga - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back