fabI

Information for fabI, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1347004-1348209 - CDS yciW EG14262 putative oxidoreductase 1348275-1349063 - CDS fabI EG11528 enoyl-[acyl-carrier-protein] reductase (NADH) 1349431-1349784 - CDS ycjD EG12653 orf; hypothetical protein

Reported regulatory sites for fabI: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.613 1349112-1349130 R cgtac TGTTTACTAAAACGACGAA tcgcc - 0 - 1.519 1349065-1349081 R catca ACAATAAGGATTAAAGC tatgg - 0 - 1.405 1349193-1349214 R ccccc CTGCCGCAGCCTGCTCCGGTCG gacct - 0 -

Critical MAP values: p=0.01 6.09 p=0.05 4.94 p=0.1 4.37 p=0.2 3.74

Click here to go back