fadB

Information for fadB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4025199-4026362 - CDS fadA EG10278 thiolase I; 3-ketoacyl-CoA thiolase; acetyl-CoA transferase 4026372-4028561 - CDS fadB EG10279 4-enzyme protein: 3-hydroxyacyl-CoA dehydrogenase; 3-hydroxybutyryl-CoA epimerase; delta(3)-cis-delta(2)-trans-enoyl-CoA isomerase; enoyl-CoA hydratase 4028751-4030082 + CDS pepQ EG10698 proline dipeptidase

Reported regulatory sites for fadB: Genome coordinates Source Transcription factor Transcription factor annotation 4028587-4028603 DPInteract fadR negative regulator for fad regulon and positive activator of fabA

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 6.276 4028587-4028603 R gactc ATCTGGTACGACCAGAT cacct fadR 17 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.767 4028618-4028640 R ttttg TTTGCATATTTTTAACACAAAAT acaca - 0 - 2.398 4028635-4028652 R atttc TTTAATCTTTTGTTTGCA tattt - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back