fadD

Information for fadD, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1884888-1886015 - CDS rnd EG10858 RNase D; processes tRNA precursor 1886085-1887770 - CDS fadD EG11530 acyl-CoA synthetase; long-chain-fatty-acid--CoA ligase 1887975-1888556 - CDS b1806 EG13511 putative outer membrane protein

Reported regulatory sites for fadD: Genome coordinates Source Transcription factor Transcription factor annotation 1887929-1887945 DPInteract fadR negative regulator for fad regulon and positive activator of fabA 1887843-1887859 DPInteract fadR negative regulator for fad regulon and positive activator of fabA

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.113 1887829-1887845 R gatga GTTAATATTATGTTAAC ggcat fadR 3 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.470 1887879-1887902 R aaaat AAATAGTGACGCGCTTCGCAACCT tttcg - 0 - 1.666 1887777-1887800 R cgatg ACGACGAACACGCATTTTAGAGGT gaaga - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back