fba

Information for fba, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3066967-3067827 - CDS yggB EG11160 putative transport protein 3068185-3069264 - CDS fba EG10282 fructose-bisphosphate aldolase; class II 3069479-3070642 - CDS pgk EG10703 phosphoglycerate kinase

Reported regulatory sites for fba: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.445 3069450-3069471 R aatca CAGGGCAGGGAAACCTGCCCTT gtttc - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.816 3069272-3069288 R ataag GCCCGACGATACAGGAC aagag - 0 - 0.549 3069400-3069423 R acgca ATTTTTCATACTCTAAATAATTCG agttg - 0 IRU13 (22)

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back